Фактор лейдена

Фактор лейдена

Аномалия гена коагуляционного фактора V1691 G>A (Лейден).

.

Как было сказано выше, аномалия гена коагуляционного фактора V 1691 G>A была обнаружена в 1994 г. R. Bertina et al. Однонуклеотидная замена гуанина на аденин в положении 1691 (1691 G>A) в экзоне 10 гена F5 обусловливает молекулярный дефект коагуляционного фактора V. Вследствие замены в положении 506 молекулы проакцелерина аргинина на глутамин (Arg506Gln) нарушается его способность разрушаться, в результате чего формируются дисфункция антикоагулянтной системы протеина С и склонность к рецидивам тромбозов. Генетическая аномалия коагуляционного фактора V (Лейден) является наиболее частым тромбофилическим дефектом у европейского населения.

Для обнаружения этой генетической аномалии используют варианты ПЦР. Высокие чувствительность и специфичность ПЦР обеспечивают синтезированные in vitro олигонуклеотиды, комплементарные соответствующему участку гена коагуляционного фактора V человека.

Отсутствие единой номенклатуры генетических дефектов обусловило распространение в современной научной литературе многочисленных обозначений этой аномалии: F5:1691 G>A, Rs6025, Arg506Gln, G1691A, R506Q, Лейден (лейденовская) и др.

Принцип метода

Для идентификации полиморфных аллелей в гене F5 используют амплификацию соответствующих участков гена методом ПЦР с последующим определением продуктов амплификации.

Реактивы и оборудование

  • Контрольные образцы с аллелем дикого типа и аллелем мутантного типа.
  • Для определения аномалии F5 1691 G>A применяют два праймера. Праймер 1 (forward primer): ACGTTGGATGC TGAAAGGTTACTTCAAGGAC, праймер 2 (reverse primer): ACGTTGGATGCTCTGGGCTAATAGGACTAC.
  • Амплификатор и другое оборудование для проведения ПЦР.

Образцы крови для исследования Материалом для исследований может быть любой источник ДНК, однако чаще используют венозную кровь, которую забирают в пробирки, содержащие ЭДТА. Образцы хранят до проведения исследования при температуре +2...+8 °С не более 24 ч. Длительно хранить образцы можно только в замороженном состоянии при температуре -40...70 °С.

Выделение ДНК из образцов клинического материала может проводиться различными методами, например с помощью наборов на основе силики, наборов с микроцентрифужными колонками, наборов на основе фенол-хлороформной экстракции и др.

Методика определения

Метод основан на многократном избирательном копировании участка ДНК с помощью ферментов in vitro. Ход исследования должен соответствовать выбранному оборудованию и процедуре ПЦР-анализа (гель-электрофорез, flash или др.).

Оценка результатов исследования

Оценка результатов проводится способами, позволяющими опеределять олигонуклеотидные полиморфные замены. Пример визуализации результатов амплификации представлен на рис. 5.1.

Варианты результатов выявления лейденовской аномалии гена коагуляционного фактора V следующие: G/A — гетерозиготная форма аномалии в положении 1691; А/А — гомозиготный вариант аномалии. В популяции преобладает генотип G/G.

Интерпретация результатов исследования

У носителей лейденовской аномалии гена F5 имеется склонность к тромбозам, риск которых существенно увеличивается при беременности, применении контрацептивов, в послеоперационный период и др. Пенетрантность гена неполная, поэтому ряд носителей не имеют в анамнезе тромботических нарушений. При наличии гомозиготного варианта этой мутации частота и тяжесть тромбозов выше. Частота обнаружения гетерозиготной аномалии, по данным литературы, составляет примерно 1-3 % в популяции.

Аминокислотная замена в положении 506 нарушает сайт расщепления молекулы коагуляционного фактора V активированным протеином С, что существенно снижает скорость его деградации. Поэтому при наличии аномалии гена F5 1691 G>A наблюдается резистентность коагуляционного фактора Va к активированному протеину С.

Обнаружение этой мутации у пациентов с рецидивами тромбозов позволяет обосновать пролонгированную антикоагулянтную профилактику. Такое исследование может оказать помощь в выявлении лиц, у которых требуется решить вопрос об использовании антикоагулянтов при осуществлении хирургических вмешательств.

Причины ошибок

  • Ошибки преаналитического этапа исследования (при нарушении сроков хранения или неправильной транспортировке биоматериала нуклеиновые кислоты могут разрушаться, что становится причиной ложноотрицательных результатов; гепарин способен ингибировать ПЦР, поэтому забор крови не должен проводиться в пробирки, содержащие гепарин).
  • Загрязнение исследуемых образцов инородным биологическим материалом.
  • Нарушение принципов зонирования лаборатории для молекулярно-генетических исследований.
  • Отказ от исследования отрицательного контроля.
  • Отказ от проведения повторного анализа положительных проб.
  • Несоблюдение технологии выделения ДНК.
  • Специфичность и чувствительность ПЦР зависят существенно от структуры праймеров, поэтому использование праймеров разных производителей может обусловливать получение отличающихся результатов.

Другие аналитические технологии

Варианты ПЦР признаны надежными лабораторными процедурами, способными обеспечить высокую чувствительность, специфичность и воспроизводимость. В подавляющем числе случаев для диагностики тромбофилического состояния, связанного с нарушением инактивации проакцелерина, можно использовать коагуляционный метод путем определения резистентности к активированному протеину С. Однако следует учитывать, что и другие нарушения (гиперпродукция антигемофильного глобулина, ВА и др.) также способны вызвать резистентность коагуляционного фактора V к активированному протеину С.

  • Оцените материал
    (1 Голосовать)
  • Прочитано 7108 раз
  • Цирроз печени
    Цирроз печени Истинный цирроз печени представляет конечную, практически необратимую стадию хронических диффузных гепатитов...
  • Базедова болезнь
    Базедова болезнь Базедова болезнь в основном характеризуется усиленным тканевым обменом и повышенной реактивностью нервной системы…
  • Тиреоидит щитовидной железы
    Тиреоидит щитовидной железы Термин «тиреоидит» охватывает воспалительные заболевания щитовидной железы с различной этиологией…
  • Синдром Кушинга
    Синдром Кушинга Хронический избыток глюкокортикоидов, независимо от своей причины, обусловливает симптомы и признаки…
  • Бронхоспазм
    Бронхоспазм Бронхоспазм — состояние острой дыхательной недостаточности, которое возникает в результате бронхиальной обструкции…
  • Гипертонический криз
    Гипертонический криз Развитие гипертонического криза сопровождается следующими симптомами...